Filling a niche: Neuralstemcells help maintain their microenvironment TMDUniversity
) cycles of denaturation at 94 °C for 20 sec, annealing at 60 °C for 30 sec, and extension at 72 °C for 45 sec. Specific primers were the following;sense primer, 5’- caggctgctgtaacgatgaagc -3’; antisense primer, 5’- caccgccttggcttgtcaca -3’;Vegfr2
sense primer, 5’- ggtctttcggtgtgttgctc -3'; antisense primer, 5’- tctgtctggctgtcatctgg -3', ß-actin sense primer, 5’- ccagggtgtgatggtgggaa -3'; antisense primer, 5’- cagcctggatggctacgtaca -3'.cDNAs were amplified by PCR from mouse cDNAs by using the identical primer set used for reverse transcription-PCR.Vegf-A
were synthesized by DIG RNA labeling kit . For in situ hybridization, RNA probes were hybridized at 65 °C for 16 hrs, and then brain sections were incubated with alkaline phosphatase-conjugated anti-DIG antibody overnight at 4 °C after blocking with Brocking Reagent . Probes were colored by 50 μg/ml of p-nitroblue tetrazolium chloride and 175 μg/ml of 5-bromo-4-chloro-3-indolyl phosphate .Embryonic brains were fixed with 4 % paraformaldehyde overnight at 4 °C.
United States Latest News, United States Headlines
Similar News:You can also read news stories similar to this one that we have collected from other news sources.
Hypothalamic inflammation and obesity, study suggests a pathological mechanismIn a recent review published in the European Journal of Endocrinology, researchers discussed current research on the relationship between human obesity and inflammation of the hypothalamus.
Read more »
Fever integrates antimicrobial defences, inflammation control, and tissue repair in a cold-blooded vertebrateBehavioural, molecular, and functional analyses revealed that fever contributes to induction and resolution phases of acute inflammation, through enhancement of antimicrobial defences, increased efficiency in inflammation control, and improved wound repair.
Read more »
Facebook Parent Meta to Cut 10,000 JobsFacebook’s parent company Meta announced Tuesday that it will make its second round of layoffs in under six months
Read more »
Western diet contributes to the pathogenesis of non-alcoholic steatohepatitis in male mice via remodeling gut microbiota and increasing production of 2-oleoylglycerol - Nature CommunicationsInterplay of western diet and gut microbiota has been reported to be involved in the development of nonalcoholic steatohepatitis (NASH). Here the authors report that Blautia producta and 2-oleoylglycerol are bacterial and metabolic mediators that promote liver inflammation and hepatic fibrosis in male mice.
Read more »
How genome doubling helps cancer developA single cell contains 2-3 meters of DNA, meaning that the only way to store it is to package it into tight coils. The solution is chromatin: a complex of DNA wrapped around proteins called histones. In the 3D space, this complex is progressively folded into a multi-layered organization composed of loops, domains, and compartments, which makes up what we know as chromosomes.
Read more »