Efficient prime editing in mouse brain, liver and heart with dual AAVs
. Specifically, the sgRNAs with the spacer sequences ‘GCAUGGCUGUCUGGUUCUGU’ and ‘GCCAGGUUCCAUGGGAUGCUC’ were ordered from Synthego with their standard chemical modifications—2′--methyl for the first three and last three bases and phosphonothioate bonds between the first three and last two bases. A 5′ ‘G’ nucleotide was included with the 20-nt pegRNA spacer sequence to recapitulate the sequence expressed from AAVs.
Liver histopathology was performed by the Rodent Histopathology Core of Harvard Medical School. Fixed liver tissue was embedded in paraffin, cut into 5-μm sections and stained with hematoxylin and eosin. Samples were analyzed by a blinded mouse histopathologist.Total DNA was isolated from liver tissue . For quantification of viral genomes, digital droplet PCR was carried out using ddPCR Supermix for Probes with 10 ng of isolated DNA used as template and 6.
. To ensure minimal DNA contamination in RNA expression analysis, RT negative controls were verified to yield only background positive droplets.Data are presented as mean and s.e.m. Sample size and the statistical tests used for each experiment are described in the figure legends. No statistical methods were used to pre-determine sample size. Statistical analysis was performed using GraphPad Prism software.
United States Latest News, United States Headlines
Similar News:You can also read news stories similar to this one that we have collected from other news sources.
Engineered phage with antibacterial CRISPR–Cas selectively reduce E. coli burden in mice - Nature BiotechnologyPhage engineered with tail fibers and CRISPR–Cas reduce Escherichia coli load in animals.
Read more »
Fast and efficient template-mediated synthesis of genetic variants - Nature MethodsA template-driven synthesis platform enables scalable kilobase-long sequence variants up to 10kb. NBThighlight
Read more »
Nature Fest and Nurtured by Nature aim to get Houstonians outdoorsThe former event at Bridgeland features an appearance from animal rescuer Jeff Musial...
Read more »
How a more efficient IRS is speeding up the debt deadlineBecause of its newfound efficiency, the government will run out of remaining funds to service its debts earlier than it expected.
Read more »
In race for efficient EVs, Mercedes taps F1 team to keep up with TeslaMercedes-Benz has plugged its Formula One team into the engineering process to build vastly more efficient mass-market electric vehicles (EVs), slashing development times by a quarter or more as it jump starts efforts to keep pace with Tesla .
Read more »
Mercedes-Benz Asked Its Formula 1 Team to Help Make More Efficient EVsMercedes-Benz is known for its luxury cars, but the automaker is now turning to its Formula 1 team to help build more efficient EVs. The move could help the German marque keep pace with Tesla and cut costs for consumers. EVs MercedesBenz Formula1
Read more »